Question 1

The term "________" indicates that the members of a clade share a common ancestor, one not shared by any group outside the clade.

Accepted Answer

A)   monogamy
B)   monophyletic group
C)   polyphyletic group
D)   monoploid
E)   polyploidF) A) and D)
G) A) and C)

Question 2

Which of the following did early methanogens use from the early atmosphere to generate energy?

Accepted Answer

A)   CO₂ and H₂
B)   H₂O and O₂
C)   CH4 and CO₂
D)   N₂ and O3
E)   O₂ and H₂F) None of the above
G) A) and B)

Question 3

All of the following are examples of "operational genes," EXCEPT ________ genes.

Accepted Answer

A)   metabolic
B)   ribosomal RNA
C)   stress response
D)   pathogenicity
E)   resistanceF) None of the above
G) B) and E)

Question 4

Four unique sequences have been amplified using PCR of the SSU rRNA gene from four unknown microorganisms. Calculate the percent relatedness of each in comparison with the known sequence given to determine which strains are most phylogenetically related. What would a molecular, rectangular phylogenetic tree of divergence of the four sequences look like?
(1) AAATGTTGGGCTTCCGGCAGTAGTGAGTG
(2) AAATGTTGGGATTCCGGAAGTAGTGAGTG
(3) AAATGCTGGGCTTCCGGAAGTAGCGAGTG
(4) AAATGATGGGCTTCCGGGAGCGAGTGCCC

Accepted Answer

The sequences have 2...

Question 5

Studies on the genome of Bacillus species have revealed that Bacillus anthracis has a "closed" pan-genome, whereas Bacillus cereus has an open pan-genome. What does this mean, and why did these two species evolve in this manner?

Accepted Answer

The pan-genome is the core genome of a s...

Question 6

The presence of cells of the alga Chorella growing within Paramecium bursaria is an example of

Accepted Answer

A)   ectosymbiosis.
B)   intracellular endosymbiosis.
C)   parasitism.
D)   commensalism.
E)   competition.F) A) and C)
G) B) and D)

Question 7

The most likely ancestor for today's mitochondria according to the endosymbiotic model is a(n)

Accepted Answer

A)   species in the genus Bacillus.
B)   rickettsia.
C)   member of the clostridia.
D)   enterobacterium related to Escherichia coli.
E)   cyanobacterium.F) B) and E)
G) A) and C)

Question 8

A clade could best be described as a

Accepted Answer

A)   random but neutral DNA mutation.
B)   hypothesis that early evolution happened faster than later evolution.
C)   group of related organisms producing a monophyletic group.
D)   hypothesis of how life began on Earth.
E)   group of genes unselected for in evolution.F) C) and D)
G) A) and B)

Question 9

In the domains of life, archaea and eukarya differ from each other in that archaea ________ and eukarya ________.

Accepted Answer

A)   contain membrane-bound organelles; do not
B)   do not undergo methanogenesis; do
C)   do not contain membrane-bound organelles; do
D)   are pathogenic to humans; are never pathogenic
E)   have introns; do notF) B) and E)
G) A) and C)

Question 10

A molecular clock is best defined as

Accepted Answer

A)   the information contained in DNA or protein sequences that shows changes over time.
B)   genes that under selective pressure show a higher rate in mutation frequencies.
C)   organisms in favorable environments that have greater offspring potential.
D)   the time between Earth's formation and the beginnings of life in an RNA world.
E)   a monophyletic group of organisms that replicate in synchrony.F) A) and D)
G) A) and B)

Exam 17: Origins and Evolution

A clade could best be described as a

Correct Answer
verified

The most likely ancestor for today's mitochondria according to the endosymbiotic model is a(n)

Correct Answer
verified

Correct Answer
verified
The sequences have 2...
View Answer

The term "________" indicates that the members of a clade share a common ancestor, one not shared by any group outside the clade.

Correct Answer
verified

In the domains of life, archaea and eukarya differ from each other in that archaea and eukarya .

Correct Answer
verified

Studies on the genome of Bacillus species have revealed that Bacillus anthracis has a "closed" pan-genome, whereas Bacillus cereus has an open pan-genome. What does this mean, and why did these two species evolve in this manner?

Correct Answer
verified
The pan-genome is the core genome of a s...
View Answer

A molecular clock is best defined as

Correct Answer
verified

Which of the following did early methanogens use from the early atmosphere to generate energy?

Correct Answer
verified

All of the following are examples of "operational genes," EXCEPT ________ genes.

Correct Answer
verified

The presence of cells of the alga Chorella growing within Paramecium bursaria is an example of

Correct Answer
verified

Exam 17: Origins and Evolution

A clade could best be described as a

Correct AnswerverifiedShow Answer

The most likely ancestor for today's mitochondria according to the endosymbiotic model is a(n)

Correct AnswerverifiedShow Answer

Correct AnswerverifiedThe sequences have 2...View AnswerShow Answer

The term "________" indicates that the members of a clade share a common ancestor, one not shared by any group outside the clade.

Correct AnswerverifiedShow Answer

In the domains of life, archaea and eukarya differ from each other in that archaea ________ and eukarya ________.

Correct AnswerverifiedShow Answer

Studies on the genome of Bacillus species have revealed that Bacillus anthracis has a "closed" pan-genome, whereas Bacillus cereus has an open pan-genome. What does this mean, and why did these two species evolve in this manner?

Correct AnswerverifiedThe pan-genome is the core genome of a s...View AnswerShow Answer

A molecular clock is best defined as

Correct AnswerverifiedShow Answer

Which of the following did early methanogens use from the early atmosphere to generate energy?

Correct AnswerverifiedShow Answer

All of the following are examples of "operational genes," EXCEPT ________ genes.

Correct AnswerverifiedShow Answer

The presence of cells of the alga Chorella growing within Paramecium bursaria is an example of

Correct AnswerverifiedShow Answer

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified
The sequences have 2...
View Answer

Correct Answer
verified

In the domains of life, archaea and eukarya differ from each other in that archaea and eukarya .

Correct Answer
verified

Correct Answer
verified
The pan-genome is the core genome of a s...
View Answer

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified